kirinaallison
kirinaallison kirinaallison
  • 02-06-2018
  • Mathematics
contestada

Write a compound inequality that the graph could represent.

Write a compound inequality that the graph could represent class=

Respuesta :

gmany
gmany gmany
  • 09-06-2018
Your answer is:
[tex]x\geq-1\ \wedge\ x < 3\to x\in\left<-1;\ 3\right)[/tex]

Answer Link

Otras preguntas

The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.
What are some methods used by Mussolini to rise to power?
a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what
What property is shown by the equation? 1. 0 ÷ (–6) = 0
a rectangle is 3 times as long as it is wide and its perimeter is 120 centimeters. find area.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Which sentence has two antecedents and one pronoun? Laurie likes to bake in her new oven. Cody and Aleena sold their car. My school does not have an October
In the years preceding World War I A)world tensions declined. B)military expenditures decreased. C)imperialistic ambitions seemed to decline. D)there was a s
Graph the six terms of a finite series where a1 = -3 and r = 1.5.