screen9544 screen9544
  • 04-06-2018
  • Biology
contestada

The ________ of the brain houses the motor cortex and areas responsible for judgment, decisions and planning.

Respuesta :

mercedesperry55 mercedesperry55
  • 04-06-2018
it should be the frontal lobe 
Answer Link

Otras preguntas

Gina rented shoes, bowled 3 games, and bought 1 order of nachos. she used a coupon for 1/2 off the price of her bowling games. What was Ginas total cost before
define concentric circles
What was religion like in Shang China?
The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?
COMPARISON; 1. How is concrete like chocolate 2. How is a shirt like a picture 3. how is an elephant like a cloud
i need help with this question
how do i find the angles on a kite?
a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
how many cups of water should be mixed with 1/4 cup of vinegar to make the cleaning solution?