03-10-2018
Mathematics

contestada

-16+(-28) adding a integer

Respuesta :

GreatR98 GreatR98

03-10-2018

the answer is equal to -44

Answer Link

mimiwhatsup mimiwhatsup

03-10-2018

-44 should be your answer. If you were solving for absolute value and the 28 was positive you would have about 12.

Answer Link

Otras preguntas

Which are barriers to seeking mental health treatment? Check all that apply. feeling embarrassed having health insurance dealing with peer pressure having limit

What is the scale factor in the dilation? A) 2/5 B) 1/2 C) 2 D) 2 and 1/2

Triangle abc has vertices a(0 0) b(6 8) and c(8 4). which equation represents the perpendicular bisector of bc

Which Romantic poet said, “I think I shall be among the English Poets after my death,” before dying of tuberculosis at 25? A. Lord Byron B. Samuel Coleridge

why did the church oppose the heliocentric theory

A sample of gas at 25ºc has a volume of 11 l and exerts a pressure of 660 mm hg. how many moles of gas are in the sample?

help me asap !!!!!!!!

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

describe five ways to set strategy for effectively gathering patients information

Which country is the world’s largest producer of wheat? USA China Russia France