kayla6240
kayla6240 kayla6240
  • 02-09-2019
  • Mathematics
contestada

pls help i dont rly understand

pls help i dont rly understand class=

Respuesta :

elich
elich elich
  • 02-09-2019
New wage 12.25 minus, raise 0.75 equal the answer. So $12.25-$0.75=$11.50 11.50 dollars was her wage before
Answer Link

Otras preguntas

According to the Ajzen model, the strongest predictor of an employee’s behavior is (are):
The temperature on a cloudy night is likely to be __________ those on a clear night all other factors being equal
If the [h+] of a 0.205m solution of phenol (c6h5oh) at 25ºc is 2.340 10-6, what is the ka for phenol? phenol is monoprotic.
Jacky spent 53% of all her money to buy a computer game. How much did the game cost, if Jacky had $120 before buying the game?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
A sample of gas at 25ºc has a volume of 11 l and exerts a pressure of 660 mm hg. how many moles of gas are in the sample?
What was a major effect of the agricultural revolution in the united states during the late 1800's?
an integer is one more than four times another. if the product of two integers is 39, then find the integers
Please help me with this one too !!!
Which of the following has faces that are pentagons?A. HexahedronB. OctahedronC. IcosahedronD. Dodecahedron