lexijustice34 lexijustice34

01-05-2020
Mathematics

contestada

what is -2+15x45=_. can you please solve this for me i am confused

Respuesta :

01-05-2020

Answer:

673

Step-by-step explanation:

-2+15x45

Multiply the numbers

-2+675

calculate

=

673

Answer Link

Otras preguntas

The width of a rectangle measures (8.4x + 2.2) centimeters, and its length measures (4.5x + 3.4) centimeters. Which expression represents the perimeter, in cent

what is the concept that refers to the conflict among roles corresponding to two or more statuses?

1. What and when was the Renaissance period?

bella blooms is a successful business that sells a liquid spray fertilizer to farmers. the fertilizer consists of rich, organic, composted material. recently, n

does anyone know the answer

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Poverty allevation is neccesary for the sustainable development.How??

how has the acceptance of evolution affected the science of taxonomy

Brainless for anyone who answers correctly (I need help) (-2/3 + 5/6) divided by 3/4

If the element you holding is shiny, conducts electricity well, is flexible, and is a solid at room temperature, What type of element are you most likely holdin