Seudónimo Seudónimo
  • 02-12-2020
  • Mathematics
contestada

Help get brainiest if u help

Help get brainiest if u help class=

Respuesta :

Heb011008
Heb011008 Heb011008
  • 02-12-2020

Answer:

32ft by 20ft

Step-by-step explanation:

8x4 and 5x4

Answer Link

Otras preguntas

In the united states during world war ii, the property of japanese americans was confiscated, and they were forcibly placed in ______.
What is the distance between 407 squared and negative 68 squared
Which of these hormones does not help control fluid balance during exercise?
What is the value of x? x = 2 x = 3 x = 4 x = 6
Mark bought a set of 6 flower pots of different sizes at a total cost of $8.25. each pot cost $0.25 more than the next one below it in size. what was the cost,
Which phrase refers to failed businesses? a. "the withered leaves of industrial enterprise" b. "serious curtailment of income" c. "no markets for their produce"
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What two molecules are produced by the light reactions and used to power the calvin cycle?
If 100 kg of cucumbers are 99% water, how much do they weigh if they are 97% water?
Solve for x and y: x-3y=-8 3x+2y=31