janash247 janash247

03-02-2021
Mathematics

contestada

will give brainliest to first correct answer. find missing length

will give brainliest to first correct answer find missing length class=

Respuesta :

luisrenteria23101989 luisrenteria23101989

03-02-2021

Answer: a

Step-by-step explanation:

Because i said so

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

An element's atomic number is 64. How many protons would an atom of this element have?

(60) Points HeLp asap 5 questions

Yahaira is ready to reach the next level in her fitness. She is in great shape, but she still lacks the power needed to lift heavy objects. Which of the followi

How did world war i and the treaty of versailles contribute to the rise of fascism in the 1920s and 30s?

Helena has five different flowers. She plans to give one flower to each of her five teachers in any order. She gives the first flower to one of her teachers in

what is the answer to #16???? Helpppppp

We had lunch: sandwiches, potato chips, and iced tea. Carolyn and her mother talked mostly about neighbors and the congregation at the Japanese Methodist Church

I need help with this problem!

These tools were crucial in scientists' and physicians' ability to work together and collaborate to solve problems and learn about disease. A) the Internet and