kimberlyxiong33 kimberlyxiong33

03-10-2021
Mathematics

contestada

X³=27
Perfect Square
Perfect Cube
Irrational

Respuesta :

akhil9553386 akhil9553386

03-10-2021

Step-by-step explanation:

x³ = 27

x³ = (3)³

∴ x = 3

∴PERFECT CUBE

Please Mark Brainlist If My Answer Is Helpful To You ☺️☺️☺️

Answer Link

Otras preguntas

Solve for x in terms of the other matrices and/or their inverses. x=b+ax

Really need some helpUse the diagram below. Write AD/AB in simplest form.

Explain the significance of the phoenix. what, according to granger, makes humans different from the phoenix?

what is the sum of odd positive integers less than 50

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

What is the value of x?

At age 76 years, which chronic condition is elizabeth most likely to have?

can someone help me please

9 students can make a poster in 10 hours. How many students should join them so that they all together can make this poster in 6 hours

What is let’s read a book in French