alliemiller17898 alliemiller17898
  • 03-02-2022
  • Health
contestada

Athletes need to consume adequate water when they get thirsty true or false

Respuesta :

mjsulli6
mjsulli6 mjsulli6
  • 03-02-2022

Answer:

True

Explanation:

Answer Link

Otras preguntas

Which section of an article would you look at to find out if assessors were blinded to treatment assignment?
Identify the vertical asymptote(s) of each function. Check all of the boxes that apply. f(x)=3x/x^2-16 Answers: x = -16 x = -4 x = 0 x = 4 x = 16
What are the asymptotes of the hyperbola with equation 9y^2 - 4x^2 = 36?
Please help ASAP!!!!!!!!!!!!!
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
In the Chinese civil war 1945-1949 support for Mao Zedongs communist forces came primarily from the
x to the 2 power plus 4x plus 3[tex]x{2} + 4x + 3 = [/tex]
Solve the system algebraically. check your work. 2x + 5y = 10 2x + 3y = 6
Which factor controls the water cycle? A. Energy from the sun B. Changing ocean currents C. Volcanic eruptions D. Burning of fossil fuels
Describe why plant cells are rigid: