kaylolingm2oni3cessi kaylolingm2oni3cessi
  • 02-02-2017
  • English
contestada

Render is another word for greed.
a. true
b. false

Respuesta :

Chrisstina
Chrisstina Chrisstina
  • 02-02-2017
The answer is : false
Render is to provide or to give.
Answer Link

Otras preguntas

a woman lifts a 300 newton child a distance of 1.5 meters in 0.75 seconds. What is her power output in lifting the child?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor
why is the square root of a perfect square always rational
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
The process of chemical cycling is known as a biogeochemical cycle because it A. takes places over a long period of time B. withdraws the
The process of chemical cycling is known as a biogeochemical cycle because it A. takes places over a long period of time B. withdraws the
What would be the most likely effect of one company buying a competitor?
what is the lcd of 10/11,29/44
On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor