kg019967kg019967 kg019967kg019967
  • 04-04-2017
  • History
contestada

what is an equation of the line in slope intercept form m=2/7 and the y intercept is 0 -12

Respuesta :

Purridotti
Purridotti Purridotti
  • 04-04-2017
y=mx+b sooo y=2/7x-12
Answer Link

Otras preguntas

How do you put allele in a sentence
31+34=90-n 45+1=70-k 6×9=41+m
Which sentence has two antecedents and one pronoun? Laurie likes to bake in her new oven. Cody and Aleena sold their car. My school does not have an October
the reproductive system of a male mammal provides
which point is in the solution set to the system of inequalities: y>2x-1 and y<1/2x+5
5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20
Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?