gil2eyB8unebooks gil2eyB8unebooks
  • 03-02-2016
  • Chemistry
contestada

If heat is added to a boiling liquid, what happens to the temperature of the liquid?
A. It increases.
B. It decreases.
C. It does not change.

Respuesta :

okeen203
okeen203 okeen203
  • 09-03-2020

Answer: C

Explanation:

Answer is "It does not change"

Hope this helps!

Answer Link

Otras preguntas

cody has 7/8 pound of cheese. he uses 1/7 since there are 16 ounces in a pound how much is left
If 2/3 + 6 = 7/6p, what is the value of p?
Renaissance painters in flanders as in italy tended to produce work that was
In a standard normal curve, what percentile corresponds to a z-score of 2.0?
Solve for x. Assume that lines which appear tangent are tangent.
Which phrase is NOT a way to state the meaning of the expression x – 3? The difference of a number and 3 A number minus 3 A number subtracted from 3 3 less than
The non-proliferation treaty attempts to prevent the spread of __________ weapons.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
(60) Points HeLp asap 5 questions
[tg.02]carbon in food molecules is transferred from animals to the geosphere through the process of